Characterisation of oil degrading bacteria from tailored compost containing crude oil sludge
Loading...
Date
Authors
Ubani, Onyedikachi
Atagana, Harrison Ifeanyichukwu
Thantsha, Mapitsi Silvester
Adeleke, Rasheed
Journal Title
Journal ISSN
Volume Title
Publisher
National Institute of Science Communication and Information Resources
Abstract
In the present study, different bacteria with polycyclic aromatic hydrocarbon (PAH)-degrading capabilities were
isolated from compost prepared from oil sludge and animal manures. These bacteria were isolated on a mineral base
medium and mineral salt agar plates. A total of 31 morphologically distinct isolates were carefully selected from 5 different
compost treatments for identification using polymerase chain reaction (PCR) of the 16S rRNA gene with specific primers
(16S-P1 PCR (5¢AGAGTTTGATCCTGGCTCAG3¢) and 16S-P2 PCR (5¢AAGGAGGTGATCCAGCCGCA3¢).
The amplicons were sequenced using 16S-PA SEQ (5/CTACGGGAGGCAGCAG3/) and sequences were compared with
the known nucleotides from the GenBank. The phylogenetic analyses of the isolates showed that they belong to 3 different
clades: Firmicutes, Proteobacteria and Actinobacteria. The bacteria identified were closely related to the genera Bacillus,
Arthrobacter, Staphylococcus, Brevibacterium, Variovorax, Paenibacillus, Ralstonia and Geobacillus. The results showed
that Bacillus species were predominant in all composts. Based on the results of the degradation of the PAH in the composts
and results of previous studies on bacterial degradation of hydrocarbons in oil, the characteristics of these bacterial isolates
suggests that they may be responsible for the breakdown of PAH of different mol wt in the composts. Thus, they may be
potentially useful for bioremediation of oil sludge during compost bioremediation.
Description
Keywords
Animal manures, Bioaugmentation, Biodegradation, Bioremediation, Composing, Oil sludge, Polymerase chain reaction (PCR), Polycyclic aromatic hydrocarbon (PAH)
Sustainable Development Goals
Citation
Ubani, O, Atagana, AH, Thantsha, MS & Adeleke, R 2016, 'Characterisation of oil degrading bacteria from tailored compost containing crude oil sludge', Indian Journal of Biotechnology, vol. 15, pp. 243-250.
